Cutaneous and renal glomerular vasculopathy as a cause of acute kidney injury in dogs in the UK
L. P. Holm, BVM CertSAM, MRCVS1, I. Hawkins, DVM, MRCVS, Dip ACVP2, C. Robin, MSc, BSc3, R. J. Newton, BVSc, MSc, PhD, FRCVS3, R. Jepson, BVSc(Dist), MVetMed, PhD, DipACVIM, DipECVIM, MRCVS4, G. Stanzani, DVM, MRCVS4, L. A. McMahon, BVetMed (Hons), DipACVIM, DipECVIM CA, MRCVS1, P. Pesavento, DVM, PhD, Dip ACVP5, T. Carr, BVMS GPcert (SAM), MRCVS6, T. Cogan, BSc (Exon), PhD (Exon)7, C. G. Couto, DVM, DipACVIM8, R. Cianciolo, VMD, PhD, DACP9 and D. J. The medical records of dogs with skin lesions and AKI, with histopathologically confirmed renal TMA, were retrospectively reviewed. Thirty dogs from across the UK were identified with clinicopathological findings compatible with CRGV. These findings included the following: skin lesions, predominantly affecting the distal extremities; AKI; and variably, anaemia, thrombocytopaenia and hyperbilirubinaemia. Known causes of AKI were excluded. The major renal histopathogical finding was TMA. All thirty dogs died or were euthanised. Shiga toxin was not canada goose factory outlet vancouver identified in the kidneys of affected dogs. Escherichia coli genes encoding shiga toxin were not identified in faeces from affected dogs. CRGV has previously been reported in greyhounds in the USA, a greyhound in the UK, without renal involvement, and a Great Dane in Germany. This is the first report of a series of non greyhound dogs with CRGV and AKI in the UK. It is variably associated with clinically relevant acute kidney injury (AKI). Skin lesions are not commonly associated with AKI in dogs, unless the canada goose outlet phone number AKI has resulted from immune mediated disease (Fournel and others 1992), certain neoplasms (Moore and others 1994), infectious diseases (Ferrer and others 1988) or vascular events, such as vasculopathy (Goldfarb and Adler 2001).
canadian goose jacket The purpose of this report is to summarise the signalment, clinicopathological findings and outcome in 30 dogs canada goose outlet seattle presenting between November 2012 and March 2014, in which canada goose outlet CRGV was suspected clinically and TMA was identified histopathologically. canadian goose jacket
canada goose coats on sale Materials and methods canada goose coats on sale
canada goose clearance sale Cases were identified by comprehensive search of computerised record systems (using keywords) at two referral practices. Case records were searched for the diagnosis of AKI, with subsequent review canada goose uk site of clinical case files and renal/dermal histopathology in order to identify cases compatible with CRGV. Further case submissions came from two other referral practices and 49 first opinion practices. Practices became aware cg-jacketsale of CRGV through a combination of: a letter in the veterinary literature (Walker and McMahon 2013), media reports and information on a specialist practice website. Dogs were included if they presented between November 1, 2012 and March 31, 2014 with skin lesions and AKI with no known identifiable cause, and with renal histopathological evidence of TMA. Sections of 3 4m were prepared from each of the tissues via microtome and affixed to lysine charged glass slides. These were stained by standard technique with haematoxylin and eosin. In addition, sections of the kidney were also stained with Warthin Starry silver canada goose outlet online uk stain and Periodic Acid Schiff. Kidneys from three dogs were also stained with Masson’s trichrome and Jones Methenamine silver method. canada goose clearance sale
All of the renal histopathology was reviewed by a canada goose outlet in chicago single veterinary pathologist (IH). Renal samples from three dogs were also submitted to a second veterinary pathologist (RC).
canada goose uk shop PCR for Dog Circovirus was performed on splenic tissueii (paraffin embedded samples and fresh frozen tissue) as previously described (Li and others 2013). canada goose uk shop
FISH for Dog Circovirusi was performed on kidney tissue using probe CTCAGACAGAGACACCGTTGCTATG as previously described (Li and others 2013). Identification of bacteria was made against both unstained and organism negative controls.
FISH for Shiga toxin:i mouse anti Shiga toxin antibody (diluted 1/100) was incubated overnight at 4C on renal tissue sections, which were then washed three times canada goose outlet legit and incubated with goat anti mouse G1 FITC conjugated secondary antibody. Slides were viewed using a fluorescence microscope.
Canada Goose sale PCR for Shiga toxin on renal tissue:iii DNA was extracted from paraffin embedded samples using the QIAampDNA FFPE Tissue Kit (Qiagen, Hilden, Germany). PCR for verotoxin 1 and 2 was then performed as previously described (Burnens and others 1995). Canada Goose sale
Canada Goose Outlet PCR for E. coli virulence genes on faeces:iv DNA was extracted from colonies of E. coli cultured from faeces (Wizard Miniprep DNA purification System, Promega). Of these, 41 cases were excluded due to limited investigation and/or incomplete medical records. Thirty cases met the inclusion criteria as affected cases with confirmed TMA on renal histopathology. Canada Goose Outlet
canada goose uk outlet Signalment, history and clinical signs canada goose uk outlet
Breeds represented were English springer spaniel (n=5), crossbreed above 20kg (n=4), flat coated retriever (n=4), whippet (n=3), border collie (n=2), Jack Russell terrier (n=2), Doberman (n=2) and one each of, canada goose outlet vancouver Labrador retriever, cocker spaniel, Staffordshire bull terrier, Hungarian vizsla, Weimaraner, Dalmatian, Tibetan terrier and crossbreed below 20kg. Median age was 4.90years (1.00 11.75years). Ten were male neutered, seven were female neutered, six were canada goose outlet parka male entire and seven were female entire. Median weight was 23.2kg (7.3 40.4kg, n=28).
cheap canada goose uk Affected cases were identified from multiple areas of northern and southern England (Fig1). Ten dogs had been in the New Forest National Park shortly (four hours to 14days) before developing skin lesions and/or becoming unwell. cheap canada goose uk
uk canada goose Map to show distribution of where confirmed cases lived. (Zoomed in view shows distribution of cases in the South of England as there were proportionally more cases from this area) uk canada goose.
Recent Comments